SubtiBank SubtiBank
ydjG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydjG

unknown
locus
BSU_06190
pI
5.38
mw
38.17 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    671,994 → 673,019

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
    description
    [Pubmed|11454200]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials

    Mutant

  • BKE06190 (Δ[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACCGTTCCCTCTCACA, downstream forward: _UP4_TTGATGATGGGAGGCGGATT
  • BKK06190 (Δ[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACCGTTCCCTCTCACA, downstream forward: _UP4_TTGATGATGGGAGGCGGATT
  • References

  • 11454200,18840696