SubtiBank SubtiBank
cstA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cstA

similar to pyruvate transporter, carbon starvation-induced protein
locus
BSU_28710
pI
8.66
mw
64.19 kDa
protein length
598 aa Sequence Blast
gene length
1797 bp Sequence Blast
function
uptake of pyruvate
product
putative pyruvate transporter, carbon starvation-induced protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,936,382 → 2,938,178

    The protein

    Catalyzed reaction/ biological activity

  • pyruvate:H+ symport [pubmed|29061664]
  • Protein family

  • peptide transporter carbon starvation (CstA) (TC 2.A.114) family (single member, according to UniProt)
  • [SW|Localization]

  • membrane (according to [http://www.uniprot.org/uniprot/P94532 UniProt])
  • Expression and Regulation

    Operons

    genes
    [gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]-[gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|search|CcpA]) [Pubmed|12850135,22900538]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B012 (cstA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1011 NBRP B. subtilis, Japan]
  • BKE28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT, downstream forward: _UP4_TAGAAGGACTATTGAAAATG
  • BKK28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT, downstream forward: _UP4_TAGAAGGACTATTGAAAATG
  • References

    The ''E. coli'' homolog

  • 1848300,29061664