SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribosomal protein
14.78 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
ribosomal protein L11 (BL11)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    118,591 → 119,016

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • Universal [SW|ribosomal protein] uL11 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-94 [Pubmed|22517742]
  • Structure

  • [PDB|1FOX] (C-terminal domain, Geobacillus stearothermophilus)
  • [PDB|2FOW] (RNA binding domain in complex with RNA, Geobacillus stearothermophilus)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • BKE01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • BKK01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • References

  • 11244072,11948165,19653700,20441189,20525796,22517742,112097,23002217,25903689,28516784,28189581