SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribosomal protein
14.78 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
ribosomal protein L11 (BL11)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    118,591 → 119,016

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • Universal [SW|ribosomal protein] uL11 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-94 [Pubmed|22517742]
  • Structure

  • [PDB|1FOX] (C-terminal domain, Geobacillus stearothermophilus)
  • [PDB|2FOW] (RNA binding domain in complex with RNA, Geobacillus stearothermophilus)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • BKE01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • BKK01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • References

  • 11244072,11948165,19653700,20441189,20525796,22517742,112097,23002217,25903689,28516784,28189581