SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


23.20 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
xylan degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of xylan/ xylose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,054,599 → 2,055,240

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->4)-beta-D-xylosidic linkages in xylans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 11 (cellulase G) family (single member, according to UniProt)
  • Structure

  • [PDB|2QZ3] (complex with xylotetraose), [PDB|2Z79], [PDB|3EXU]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8628241], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|8012596]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|pps]' and '[protein|search|xynA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE18840 (Δ[gene|F97B0839946A7B457A203769D1C87A3E58A7BE33|xynA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCTCCTATAAT, downstream forward: _UP4_TAACAGATCATCCTTAATCA
  • BKK18840 (Δ[gene|F97B0839946A7B457A203769D1C87A3E58A7BE33|xynA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCTCCTATAAT, downstream forward: _UP4_TAACAGATCATCCTTAATCA
  • References


  • 20735481
  • Original publications

  • 19531602,8012596,18957862,19422059,19994888,20096384,20188130,21466172,8628241,20525796,21966517,21785938,24271172,21964501,23459129,25096197,26279676,26923808,26955749,28109807