SubtiBank SubtiBank
ymfC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymfC

similar to transcriptional regulator ([SW|GntR family])
locus
BSU_16810
pI
6.40
mw
27.75 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|GntR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    1,754,785 → 1,755,510

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|2WV0] ([protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR], corresponds to aa 83 ... 307 of YmfC, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]-[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B115 (ymfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1114 NBRP B. subtilis, Japan]
  • BKE16810 (Δ[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC, downstream forward: _UP4_TAAAAACGGACGCCTGTATG
  • BKK16810 (Δ[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC, downstream forward: _UP4_TAAAAACGGACGCCTGTATG
  • References

  • 23504016,20047956