SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to site-specific recombinase
34.89 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    738,995 → 739,897

    Biological materials


  • MGNA-A958 (yefB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA
  • BKK06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA