SubtiBank SubtiBank
yvoD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvoD

unknown
locus
BSU_34980
pI
9.84
mw
33.45 kDa
protein length
312 aa Sequence Blast
gene length
939 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,592,457 → 3,593,395

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]-[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]
    description
    [Pubmed|9465101]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP2943 Δ''[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A389 (yvoD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/389 NBRP B. subtilis, Japan]
  • GP851 (Δ([gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF])::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE34980 (Δ[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCATCCCCCTTTGT, downstream forward: _UP4_TCAGCGGTTGGAAAGGAAGC
  • BKK34980 (Δ[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCATCCCCCTTTGT, downstream forward: _UP4_TCAGCGGTTGGAAAGGAAGC
  • References

  • 9465101