SubtiBank SubtiBank
cotD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotD

spore coat protein (inner)
locus
BSU_22200
pI
7.37
mw
8.70 kDa
protein length
gene length
228 bp Sequence Blast
function
resistance of the spore
product
spore coat protein (inner)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.7|Class VI]
  • Gene

    Coordinates
    2,332,784 → 2,333,011

    The protein

    [SW|Localization]

  • inner spore coat [Pubmed|19933362], localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [SW|SpoIIID], [protein|search|GerE]) [Pubmed|15383836,15699190,7966271]
  • view in new tab

    genes
    [gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]-[gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]-[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • 1S104 ( ''cotD''::''cat''), [Pubmed|2821284], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S104&Search=1S104 BGSC]
  • BKE22200 (Δ[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAATCCCCTTTCC, downstream forward: _UP4_TAGTATGGAAAACGTGCAGC
  • BKK22200 (Δ[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAATCCCCTTTCC, downstream forward: _UP4_TAGTATGGAAAACGTGCAGC
  • References

    Reviews

  • 23202530
  • Original publications

  • 19933362,1518043,2821284,2492118,1691789,14651647,15699190,7966271,22171814,15383836