SubtiBank SubtiBank
nasD

nasD

assimilatory nitrite reductase (subunit)
locus
BSU_03300
pI
4.95
mw
88.24 kDa
protein length
805 aa Sequence Blast
gene length
2418 bp Sequence Blast
function
utilization of nitrite as nitrogen source
product
assimilatory nitrite reductase (subunit)
essential
no
ec
1.7.1.4
synonyms
nasBC,nirB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • Gene

    Coordinates
    355,764 → 358,181

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O + 3 NADP+ + NH4+ --> 5 H+ + 3 NADPH + nitrite (according to UniProt)
  • 2 H2O + 3 NAD+ + NH4+ --> 5 H+ + 3 NADH + nitrite (according to UniProt)
  • Protein family

  • nitrite and sulfite reductase 4Fe-4S domain family (with [protein|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|CysI], according to UniProt)
  • Paralogous protein(s)

  • [protein|3F87227DC3371746B3823730B6A7024D348C151E|NasB]
  • [SW|Cofactors]

  • Fe-S cluster [Pubmed|11289299]
  • FAD [Pubmed|11289299]
  • Expression and Regulation

    Operons

    genes
    [gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|7836289]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    genes
    [gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|9765565]

    regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • 1A973 ( ''nasD''::''phleo''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A973&Search=1A973 BGSC]
  • BKE03300 (Δ[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGATGATCCGCTCCTT, downstream forward: _UP4_TAATGACAAAAACTATCATT
  • BKK03300 (Δ[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGATGATCCGCTCCTT, downstream forward: _UP4_TAATGACAAAAACTATCATT
  • References

    Reviews

  • 22103536,11289299
  • Original publications

  • 12823818,7868621,8799114,9765565,10972836,16885456,21091510,24214949,25755103,28439033