SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


modulator of lipid biosynthesis
14.55 kDa
protein length
135 aa Sequence Blast
gene length
408 bp Sequence Blast
control of fatty acid biosynthesis
modulator of lipid biosynthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.13|Quasi-essential genes]
  • Gene

    2,529,926 → 2,530,333

    Phenotypes of a mutant

  • the mutant readily acquires suppressor mutants that result in reduced activity of the [SW|ACCase] [pubmed|28579978]
  • the mutant forms lipophilic clusters [pubmed|28579978]
  • The protein

    Protein family

  • asp23 family (with [protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|YloU], according to UniProt)
  • Paralogous protein(s)

  • [protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|YloU]
  • [SW|Localization]

  • cell poles [pubmed|28579978]
  • Expression and Regulation




  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-C367 (yqhY::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1468 (Δ''yqhY''::''erm''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • GP1765 (Δ''yqhY''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • BKE24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|yqhY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC
  • BKK24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|yqhY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC
  • Expression vectors

  • GP1474 (chromosomal ''yqhY''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1322 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP1325 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP1496 (His-tag, purification from ''E. coli'', in pET28a+), available in [SW|Jörg Stülke]'s lab
  • pGP1498 (N-terminal His-tag, TEV-site, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1471 (spc, based on [SW|pBP43]), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1481 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17114254,7592499,23420519,24178028,28579978