SubtiBank SubtiBank
gamR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gamR

transcriptional repressor ([SW|GntR family]) of the [gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP] operon
locus
BSU_02370
pI
5.56
mw
26.45 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
regulation of glucosamine utilization
product
transcriptional regulator ([SW|GntR family])
essential
no
synonyms
ybgA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    257,791 → 258,498

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Effectors of protein activity

  • glucosamine-6-phosphate acts as molecular inducer that prevents GamR from binding to its operator sites in the promoter regions of the [gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP] and [gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]-[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB] operons [Pubmed|24673833]
  • Structure

  • [PDB|2WV0] ([protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR], 34% identity) [pubmed|20047956]
  • Expression and Regulation

    Operons

    genes
    [gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]-[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
    description
    [Pubmed|23667565]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|gamR]) [Pubmed|24673833,23667565]
  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials

    Mutant

  • BKE02370 (Δ[gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCCCATTCT, downstream forward: _UP4_TAAAGCAATGTGTTTTAAGA
  • BKK02370 (Δ[gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCCCATTCT, downstream forward: _UP4_TAAAGCAATGTGTTTTAAGA
  • References

    Reviews

  • 26159076
  • Original publications

  • 10627040,23667565,24673833,20047956