SubtiBank SubtiBank
yaaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yaaA

ribosome assembly factor, participates in the assembly of the 50S subunit of the ribosome
locus
BSU_00030
pI
4.33
mw
7.79 kDa
protein length
gene length
216 bp Sequence Blast
function
assembly of the 50S subunit of the ribosome
product
ribosome assembly factor
synonyms
rlbA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • Gene

    Coordinates
    3,206 → 3,421

    Phenotypes of a mutant

  • enhanced expression suppresses the defects of a temperature-sensitive ''[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]'' mutant [Pubmed|24637032]
  • The protein

    Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 12-69) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B879 (yaaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1878 NBRP B. subtilis, Japan]
  • BKE00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA, downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
  • BKK00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA, downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
  • References

  • 2987848,24637032