SubtiBank SubtiBank
yaaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaA

ribosome assembly factor, participates in the assembly of the 50S subunit of the ribosome
locus
BSU_00030
pI
4.33
mw
7.79 kDa
protein length
gene length
216 bp Sequence Blast
function
assembly of the 50S subunit of the ribosome
product
ribosome assembly factor
synonyms
rlbA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • Gene

    Coordinates
    3,206 → 3,421

    Phenotypes of a mutant

  • enhanced expression suppresses the defects of a temperature-sensitive ''[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]'' mutant [Pubmed|24637032]
  • The protein

    Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 12-69) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B879 (yaaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1878 NBRP B. subtilis, Japan]
  • BKE00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA, downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
  • BKK00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA, downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
  • References

  • 2987848,24637032