SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


effector protein controlling [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] diadenylate cyclase activity
52.78 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
regulation of c-di-AMP synthesis
effector protein controlling [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] diadenylate cyclase activity

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • Gene

    197,027 → 198,478

    The protein

    Catalyzed reaction/ biological activity

  • stimulates [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA] activity upon protein-protein interaction [Pubmed|23192352]
  • [SW|Domains]

  • YbbR-like 1 domain (aa 55-135) (according to UniProt)
  • YbbR-like 2 domain (aa 143-228) (according to UniProt)
  • YbbR-like 3 domain (aa 237-316) (according to UniProt)
  • YbbR-like 4 domain (aa 329-394) (according to UniProt)
  • Structure

  • [PDB|2KPU] (one YbbR domain, from ''Desulfitobacterium hafniense'') [Pubmed|21154411]
  • [SW|Localization]

  • cell membrane, oriented towards the outside [Pubmed|26240071]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • GP999 (''[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP985 (''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]''-''[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE01760 (Δ[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA, downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
  • BKK01760 (Δ[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA, downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
  • Expression vectors

  • IPTG inducible expression of Strep-''cdaR'' in ''E. coli'': pGP2565 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of His-''cdaR'' in ''E. coli'': pGP2557 (in [ pET19b]), available in [SW|Jörg Stülke]'s lab
  • GP2031: ''cdaR-Strep aphA3'', chromosomal expression in B. subtilis, for [protein|search|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab. Respective plasmids: pGP1989 and pGP1992.
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • References


  • 25869574,30224435
  • Original publications

  • 12884008,16236721,26240071,23192352,22211522,21154411,26025048,26527648,27834680