SubtiBank SubtiBank
cysL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cysL

transcriptional activator of the [gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]-[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI] operon
locus
BSU_37650
pI
6.96
mw
34.04 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
regulation of cysteine biosynthesis
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms
ywfK,ipa-89d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,864,309 → 3,865,208

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • defective in [SW|biofilm formation] [pubmed|30718304]
  • The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Structure

  • [PDB|5Y2V] (from Synechocystis sp., 31% identity) [pubmed|29279392]
  • Expression and Regulation

    Operons

    genes
    [gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]
    description
    [Pubmed|12169591]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: auto-repression, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • repressed by sulfate, sulfite, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B668 (ywfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1667 NBRP B. subtilis, Japan]
  • BKE37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • BKK37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • References

  • 12169591,30718304,29279392