SubtiBank SubtiBank
cysL
The papers of the month are back! Check them out! Link here

cysL

transcriptional activator of the cysJ-cysI operon
locus
BSU37650
pI
6.96
mw
34.04 kDa
protein length
299 aa Sequence Blast
gene length
897 bp Sequence Blast
function
regulation of cysteine biosynthesis
product
transcriptional regulator (LysR family)
essential
no
synonyms
ywfK, ipa-89d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,864,309 → 3,865,208

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • The protein

    Protein family

  • [SW|LysR family]
  • Expression and Regulation

    Operons

    genes
    [gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]
    description
    [Pubmed|12169591]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: auto-repression, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • repressed by sulfate, sulfite, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B668 (ywfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1667 NBRP B. subtilis, Japan]
  • BKE37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • BKK37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • References

  • 12169591