SubtiBank SubtiBank
ytzB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytzB

unknown
locus
BSU_29870
pI
8.09
mw
11.53 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,056,479 → 3,056,796

    Expression and Regulation

    Operons

    genes
    [gene|FB4788CD26D8639DE91A27E1065B0D7C7D729C57|ytzB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B533 (ytzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1532 NBRP B. subtilis, Japan]
  • BKE29870 (Δ[gene|FB4788CD26D8639DE91A27E1065B0D7C7D729C57|ytzB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAAGCACCTCCTGG, downstream forward: _UP4_TAACACCGGACAAGCAAAAA
  • BKK29870 (Δ[gene|FB4788CD26D8639DE91A27E1065B0D7C7D729C57|ytzB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAAGCACCTCCTGG, downstream forward: _UP4_TAACACCGGACAAGCAAAAA