SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to 16S rRNA methyltransferase
32.89 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
rRNA modification
16S rRNA methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation/ based on similarity]
  • Gene

    43,921 → 44,799

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the 2'-O-methylation of the ribose of cytidine 1402 (C1402) in 16S rRNA (according to UniProt)
  • cytidine1402 in 16S rRNA + S-adenosyl-L-methionine --> 2'-O-methylcytidine1402 in 16S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3KWP] (from ''Lactobacillus brevis'', 51% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation


    view in new tab



  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B903 (yabC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • BKK00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • References

  • 19965768,22383849