SubtiBank SubtiBank
mmgB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mmgB

3-hydroxyacyl-CoA dehydrogenase (acetoacetyl-CoA)
locus
BSU_24160
pI
6.60
mw
26.92 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
mother cell metabolism
product
3-hydroxyacyl-CoA dehydrogenase (acetoacetyl-CoA)
essential
no
ec
1.1.1.157
synonyms
yqiM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,511,973 → 2,512,836

    The protein

    Catalyzed reaction/ biological activity

  • (3S)-hydroxybutanoyl-CoA + NADP+ --> acetoacetyl-CoA + H+ + NADPH (according to UniProt)
  • Protein family

  • 3-hydroxyacyl-CoA dehydrogenase family (with [protein|4787161A022E938A6D58A505D92369F889C7DE04|FadN], according to UniProt)
  • Structure

  • [PDB|4R1N] (from Clostridium butyricum, 56% identity) [pubmed|25112316]
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24160 (Δ[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATCCCCTTTTTCA, downstream forward: _UP4_TGAAGTCTATTCCATCCGGG
  • BKK24160 (Δ[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATCCCCTTTTTCA, downstream forward: _UP4_TGAAGTCTATTCCATCCGGG
  • References

  • 8759838,15699190,25112316,30792386