SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


fatty acid binding protein
31.43 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
phosphorylation of fatty acids
fatty acid binding protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • Gene

    3,643,664 → 3,644,509

    The protein

    Catalyzed reaction/ biological activity

  • binds and presents fatty acids for phosphorylation to [protein|5DE73E8005AFFD30EB84696B2C2474899C6D1982|FakA] (based on findings for homologous proteins from Staphylococcus aureus) [pubmed|30429218]
  • Paralogous protein(s)

  • [protein|C13F1870B014F8B2C16D9B169F40747DE5B51B85|YitS]
  • [SW|Domains]

  • DegV domain (aa 3-280) (according to UniProt)
  • Structure

  • [PDB|3FYS] [pubmed|19390149]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A387 (yviA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT, downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
  • BKK35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT, downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
  • References

  • 19390149,8412657,30429218