SubtiBank SubtiBank
asnS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

asnS

asparagyl-tRNA synthetase
locus
BSU_22360
pI
5.12
mw
48.92 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
translation
product
asparagyl-tRNA synthetase
essential
no
ec
6.1.1.22
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.10|Aminoacyl-tRNA synthetases]
  • Gene

    Coordinates
    2,346,224 → 2,347,516

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + L-asparagine + tRNAAsn --> AMP + diphosphate + H+ + L-asparaginyl-tRNAAsn (according to UniProt)
  • Protein family

  • [SW|Class-II aminoacyl-tRNA synthetase family] (according to UniProt)
  • Structure

  • [PDB|1X56] (from ''Pyrococcus horikoshii'', 42% identity) [Pubmed|16753178]
  • Expression and Regulation

    Operons

    genes
    [gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]-[gene|C9FEE07601AD28B2651EB881A1D9B34D5082237C|dnaD]-[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]-[gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2934 (10 bp deletion at bp 1013) (no resistance) available in [SW|Jörg Stülke]'s lab
  • BKE22360 (Δ[gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATATTTCCCTCCAAAA, downstream forward: _UP4_TAATACATTCAAATGAAACA
  • BKK22360 (Δ[gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATATTTCCCTCCAAAA, downstream forward: _UP4_TAATACATTCAAATGAAACA
  • References

  • 16753178,28189581