SubtiBank SubtiBank
hutG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hutG

formiminoglutamate hydrolase
locus
BSU_39380
pI
5.44
mw
34.91 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
histidine utilization
product
formiminoglutamate hydrolase
essential
no
ec
3.5.3.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.5|Utilization of histidine]
  • Gene

    Coordinates
    4,046,503 → 4,047,462

    The protein

    Catalyzed reaction/ biological activity

  • H2O + N-formimidoyl-L-glutamate --> formamide + L-glutamate (according to UniProt)
  • Protein family

  • arginase family (with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|RocF] and [protein|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|SpeB], according to UniProt)
  • Structure

  • [PDB|3M1R]
  • Expression and Regulation

    Operons

    genes
    [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8071225], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8071225], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8682780], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP]: antitermination, at a protein-dependent [SW|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP regulon]
  • regulation

  • induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
  • view in new tab

    Biological materials

    Mutant

  • BKE39380 (Δ[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGGCCTCTCTGAGAAAAG, downstream forward: _UP4_TGATCTTCTGGCAGGTTGTA
  • BKK39380 (Δ[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGGCCTCTCTGAGAAAAG, downstream forward: _UP4_TGATCTTCTGGCAGGTTGTA
  • References

    Reviews

  • 22933560
  • Original publications

  • 10746760,8682780,10217782,8071225