SubtiBank SubtiBank
kduD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

kduD

2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase
locus
BSU_22140
pI
6.50
mw
27.04 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
utilization of galacturonic acid
essential
no
ec
1.1.1.125
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • Gene

    Coordinates
    2,326,683 → 2,327,447

    The protein

    Catalyzed reaction/ biological activity

  • 2-dehydro-3-deoxy-D-gluconate + NAD+ --> 3-deoxy-D-glycero-2,5-hexodiulosonate + H+ + NADH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]:
  • Structure

  • [PDB|4HP8] (from Agrobacterium tumefaciens, 54% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CFAEF60AD73F18C8DB5EF042210602B149D51152|kduI]-[gene|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD]
    description
    [Pubmed|17322190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17322190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|17322190], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|17322190], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|KdgR]) [Pubmed|17322190]
  • view in new tab

    Biological materials

    Mutant

  • BKE22140 (Δ[gene|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAGGCGTCATGTAGATAAC, downstream forward: _UP4_TGACAAATAAAAAAGCTGAC
  • BKK22140 (Δ[gene|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAGGCGTCATGTAGATAAC, downstream forward: _UP4_TGACAAATAAAAAAGCTGAC
  • References

  • 17322190