SubtiBank SubtiBank
ysmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ysmB

similar to transcriptional regulator (MarR family)
locus
BSU_28400
pI
6.51
mw
17.00 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,904,043 → 2,904,483

    The protein

    Structure

  • [PDB|2RDP] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]-[gene|36FF9F097682D8BA8D7359BFEAF71ACE8E9E90D8|racE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B016 (ysmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1015 NBRP B. subtilis, Japan]
  • BKE28400 (Δ[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCCATCCCTCACTC, downstream forward: _UP4_GAAATGAAGAGAAAATGAGG
  • BKK28400 (Δ[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCCATCCCTCACTC, downstream forward: _UP4_GAAATGAAGAGAAAATGAGG
  • References

  • 22383849