SubtiBank SubtiBank
brxA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

brxA

bacilliredoxin
locus
BSU21860
pI
4.62
mw
15.73 kDa
protein length
144 aa Sequence Blast
gene length
432 bp Sequence Blast
function
de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE]
product
bacilliredoxin
essential
no
synonyms
yphP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,300,221 → 2,300,655

    The protein

    Catalyzed reaction/ biological activity

  • de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE] [Pubmed|24313874]
  • Protein family

  • scpA family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|BrxB]
  • [SW|Domains]

  • contains an CxC redox motif [Pubmed|20308541]
  • Modification

  • S-bacillithiolation upon hypochlorite stress on Cys-53 [Pubmed|21749987]
  • Structure

  • [PDB|3FHK] [Pubmed|19653655]
  • Expression and Regulation

    Operons

    genes
    [gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yphP.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-A879 (yphP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/879 NBRP B. subtilis, Japan]
  • CS213 (''[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE21860 (Δ[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGCCCCCTCTA, downstream forward: _UP4_TAAATGCCCGTTCTCCGGGC
  • BKK21860 (Δ[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGCCCCCTCTA, downstream forward: _UP4_TAAATGCCCGTTCTCCGGGC
  • References

  • 22938038,19653655,20308541,21749987,24313874