SubtiBank SubtiBank
yesK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yesK

unknown
locus
BSU_06930
pI
11.36
mw
14.62 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    757,676 → 757,978

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]-[gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]-[gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]-[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]-[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]
    description
    [Pubmed|7768848]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7768848,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7768848], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|7768848]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A956 (yesK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/956 NBRP B. subtilis, Japan]
  • BKE06930 (Δ[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGCCCCCTGCAAAG, downstream forward: _UP4_TAAGGCTGCTGCCGTCTCTC
  • BKK06930 (Δ[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGCCCCCTGCAAAG, downstream forward: _UP4_TAAGGCTGCTGCCGTCTCTC
  • References

  • 7768848