SubtiBank SubtiBank
ykvP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykvP

unknown
locus
BSU_13780
pI
9.81
mw
46.13 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,444,099 → 1,445,298

    The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • [SW|LysM domain] (aa 343-386) (according to UniProt)
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FC4C5377EF1D794DCB19D0A8AFE958B84BD9C8BE|ykvP]-[gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]-[gene|BC8CBFF0C2F3C2BEE3275E2CB65D41F2AFC0A1CD|ykvQ]-[gene|4FDAD5E5660EDB346A37C1F41BD8B7B66561E529|ykzR]
    description
    [Pubmed|11011148,22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|11011148,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|11011148,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A792 (ykvP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/792 NBRP B. subtilis, Japan]
  • BKE13780 (Δ[gene|FC4C5377EF1D794DCB19D0A8AFE958B84BD9C8BE|ykvP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACATTTCCATCCTCTCT, downstream forward: _UP4_TTATTCTAAAGGAGAGTAAT
  • BKK13780 (Δ[gene|FC4C5377EF1D794DCB19D0A8AFE958B84BD9C8BE|ykvP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACATTTCCATCCTCTCT, downstream forward: _UP4_TTATTCTAAAGGAGAGTAAT
  • References

    Reviews

  • 18430080
  • Original publications

  • 11011148,15699190