SubtiBank SubtiBank
dprA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dprA

conveys incoming ssDNA to [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]; facilitates the displacement of both SSBs ([protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]), increases [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleation onto SSB-coated ssDNA, and mediates DNA strand annealing, required to internalize and to recombine ssDNA with homologous resident duplex
locus
BSU_16110
pI
9.76
mw
32.78 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
[category|SW 3.1.5|DNA repair/ recombination]
product
recombination mediator protein
essential
no
synonyms
smf

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,682,580 → 1,683,473

    Phenotypes of a mutant

  • strongly impaired genetic recombination [Pubmed|23779106]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
  • loss of plasmid transformation [pubmed|30050509]
  • The protein

    Catalyzed reaction/ biological activity

  • binds ssDNA, promotes displacement of [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] and [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] from ssDNA [Pubmed|23779106]
  • provides [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] access to ssDNA during chromosomal transformation (together with [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]) [Pubmed|22373918]
  • [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] as an accessory factor [Pubmed|25138221]
  • Protein family

  • DprA/Smf family (single member, according to UniProt)
  • Structure

  • [PDB|3UQZ] (aa 90 ... 310, from Streptococcus pneumoniae, 44% identity) [pubmed|22904190]
  • [SW|Localization]

  • transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery [Pubmed|17630974]
  • Expression and Regulation

    Operons

    genes
    [gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]-[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]-[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (2.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • expression is heterogeneous [pubmed|29809139]
  • view in new tab

    additional information

  • expressed under conditions that trigger genetic competence ([protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]) [Pubmed|11948146]
  • Biological materials

    Mutant

  • BKE16110 (Δ[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
  • BKK16110 (Δ[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
  • References

  • 17630974,17803906,12421306,18045469,11948146,22373918,23779106,23440217,25138221,26786319,28618091,22904190,28911099,30050509