SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


peptidoglycan hydrolytic L,D-endopeptidase
18.97 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
cell wall turnover
peptidoglycan hydrolytic L,D-endopeptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    303,804 → 304,307

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between L-Ala (position 1 in the peptioglycan peptide) and D-Glu (position 2) [Pubmed|18266855]
  • Protein family

  • peptidase M15C family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|17588176]
  • Biological materials


  • BKE02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC, downstream forward: _UP4_GAGATGATTCCTAACTAGAC
  • BKK02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC, downstream forward: _UP4_GAGATGATTCCTAACTAGAC
  • labs

  • [SW|Ciaran Condon], IBPC, Paris, France [ Homepage]
  • References


  • 18266855
  • Original publications

  • 17588176