SubtiBank SubtiBank
yceK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceK

similar to transcriptional regulator ([SW|ArsR family])
locus
BSU_02970
pI
8.89
mw
11.35 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    320,421 → 320,723

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 8-100) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yceK.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-C114 (yceK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2112 NBRP B. subtilis, Japan]
  • TMB150 (''yceK''::''spc''), available in [SW|Erhard Bremer]'s lab [Pubmed|23175650]
  • BKE02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG, downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
  • BKK02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG, downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
  • References

  • 23175650,23504016