SubtiBank SubtiBank
ykcC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykcC

similar to lipoteichoic acid glycosyltransferase
locus
BSU_12890
pI
8.01
mw
37.22 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
decoration of lipoteichoic acid with galactose residues
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,356,447 → 1,357,418

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB]
  • [protein|EF18470AD2B07755431534B52A8FCE6754FDBA9D|YkoT]:
  • Structure

  • [PDB|5EKP] (from Synechocystis sp., 47% identity) [pubmed|26729507]
  • [SW|Localization]

  • cell membrane (heterogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|ykcB]-[gene|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|ykcC]
    description
    [Pubmed|18175906]

    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A739 (ykcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/739 NBRP B. subtilis, Japan]
  • BKE12890 (Δ[gene|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|ykcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTCTGCTCATGTTTTTGC, downstream forward: _UP4_TAACCTCAAACCCCCTGTCC
  • BKK12890 (Δ[gene|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|ykcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTCTGCTCATGTTTTTGC, downstream forward: _UP4_TAACCTCAAACCCCCTGTCC
  • References

  • 20512483,18175906,16479537,21630458,27185829,26729507