SubtiBank SubtiBank
pghL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pghL

phage-derived gamma polyglutamic acid hydrolase, sporulation protein
locus
BSU_17820
pI
6.92
mw
28.07 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
polyglutamic acid degradation
product
phage-derived gamma polyglutamic acid hydrolase
essential
no
synonyms
yndL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,915,221 → 1,915,979

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of polyglutamic acid [Pubmed|26158264]
  • Protein family

  • [SW|UPF0714 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|PghZ], [protein|BA7D1D112E934B68073DFC1F76248ED6157240E3|PghB], [protein|DF95DED9A6E2160C151D7664C951B198EEA225E8|PghC]
  • [SW|Domains]

  • DUF867 [http://pfam.xfam.org/family/PF05908 x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]
  • Structure

  • [PDB|5ONJ] (complex with poly-γ-glutamate) [pubmed|30387270]
  • [PDB|3A9L] (from B. subtilis phage NIT1, 36% identity) [pubmed|22105902]
  • [PDB|6HRI] (native)
  • [PDB|6HRJ] (apo-form)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|pghL]
    description
    [Pubmed|16385044]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,16385044], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell[Pubmed|16385044]
  • additional information

  • An [ncRNA|search|antisense RNA], '[protein|search|surA]', is predicted for '[protein|search|pghL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B113 (yndL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1112 NBRP B. subtilis, Japan]
  • BKE17820 (Δ[gene|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|pghL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTACTCCGCCTCTAAGT, downstream forward: _UP4_TGAAAAATAGGAGGCGATAA
  • BKK17820 (Δ[gene|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|pghL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTACTCCGCCTCTAAGT, downstream forward: _UP4_TGAAAAATAGGAGGCGATAA
  • References

  • 16385044,20525796,26158264,27766092,22105902,30387270