SubtiBank SubtiBank
comQ
The papers of the month are back! Check them out! Link here

comQ

prenylation of [protein|search|comX ]and surfactin expression ([gene|search|srfA])
locus
BSU31710
pI
4.89
mw
34.05 kDa
protein length
299 aa Sequence Blast
gene length
897 bp Sequence Blast
function
regulation of quorum sensing
product
prenyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,256,008 → 3,256,907

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • prenylation of [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX] on W-53 [Pubmed|22878193]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]
    description
    [Pubmed|1715859]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715859], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • BKE31710 (Δ[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCTTGATCCGGA, downstream forward: _UP4_AGTTATACAAAGGGGGATAC
  • BKK31710 (Δ[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCTTGATCCGGA, downstream forward: _UP4_AGTTATACAAAGGGGGATAC
  • References

    Reviews

  • 28326143
  • Original publications

  • 12067344,25666134,19605685,22878193,11133937,1715859,19114482,24296669,24425772,24788106,25036949,25757097,26787913,29038467