SubtiBank SubtiBank
rhaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhaA

L-rhamnose isomerase
locus
BSU_31180
pI
5.35
mw
48.48 kDa
protein length
424 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
rhamnose utilization
product
L-rhamnose isomerase
essential
no
ec
5.3.1.14
synonyms
yulE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.12|Utilization of rhamnose]
  • Gene

    Coordinates
    3,197,933 → 3,199,207

    The protein

    Catalyzed reaction/ biological activity

  • L-rhamnose = L-rhamnulose [Pubmed|26712933]
  • Protein family

  • rhamnose isomerase family (single member, according to UniProt)
  • Structure

  • [PDB|3P14] (from B. halodurans, 78% identity) [pubmed|24925069]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|26712933,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    genes
    [gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|22383849]

    regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B544 (yulE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1543 NBRP B. subtilis, Japan]
  • BKE31180 (Δ[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCTCTCCCTTTA, downstream forward: _UP4_TAATAAAAAATCCGCCGCGG
  • BKK31180 (Δ[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCTCTCCCTTTA, downstream forward: _UP4_TAATAAAAAATCCGCCGCGG
  • References

  • 26712933,10960106,24391637,22383849,24925069