SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative quinone oxidoreductase, Zn-dependent and NAD(P)-binding
34.60 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
putative quinone oxidoreductase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,106,524 → 1,107,516

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • [SW|Cofactors]

  • NADP+ (according to UniProt)
  • Structure

  • [PDB|1TT7] (99% identity)
  • [PDB|1Y9E] (with NAD), [PDB|1TT7]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A715 (yhfP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10320 (Δ[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGCACACTCCTTTTC, downstream forward: _UP4_TAACAGGATCAGCTTGCAGA
  • BKK10320 (Δ[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGCACACTCCTTTTC, downstream forward: _UP4_TAACAGGATCAGCTTGCAGA