SubtiBank SubtiBank
ccpC
The papers of the month are back! Check them out! Link here

ccpC

transcriptional repressor of [gene|search|citZ ]and [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]
locus
BSU14140
pI
5.93
mw
33.76 kDa
protein length
293 aa Sequence Blast
gene length
879 bp Sequence Blast
function
regulation of tricarboxylic acid branch of the TCA cycle
product
transcriptional repressor ([SW|LysR family])
essential
no
synonyms
ykuM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    1,486,045 → 1,486,926

    The protein

    Protein family

  • [SW|LysR family]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000024 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]
    description
    [Pubmed|16395550]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|11985717], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed in the presence of glucose and glutamate ([protein|search|CcpC]) [Pubmed|11985717]
  • view in new tab

    genes
    [gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|ykuL]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]
    description
    [Pubmed|16395550]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]~P [Pubmed|18840696,14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A774 (ykuM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/774 NBRP B. subtilis, Japan]
  • GP206 (''aphA3'') & GP1442 (''aphA3'') , available in [SW|Stülke] lab
  • BKE14140 (Δ[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCCTCCTTTTTGT, downstream forward: _UP4_TAAAGACAGCGAGGTGCTGT
  • BKK14140 (Δ[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCCTCCTTTTTGT, downstream forward: _UP4_TAAAGACAGCGAGGTGCTGT
  • Expression vector

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP706, available in [SW|Stülke] lab
  • lacZ fusion

  • pGP707 (in [protein|search|pAC5]), available in [SW|Stülke] lab, pGP711 (in [protein|search|pAC6]), available in [SW|Stülke] lab
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • References

  • 17994626,23139400,11985717,10656796,12591885,14636591,16395550