SubtiBank SubtiBank
ycbN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycbN

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_02570
pI
8.51
mw
31.54 kDa
protein length
307 aa Sequence Blast
gene length
924 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • Gene

    Coordinates
    280,086 → 281,009

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 5-233) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, corresponds to aa 4 ... 212, 40% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]-[gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]-[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]-[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C036 (ycbN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2034 NBRP B. subtilis, Japan]
  • BKE02570 (Δ[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTTGTTTCTCCTTCCC, downstream forward: _UP4_GCGTAAAGGAGGAGAGACAC
  • BKK02570 (Δ[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTTGTTTCTCCTTCCC, downstream forward: _UP4_GCGTAAAGGAGGAGAGACAC
  • References

  • 10092453