SubtiBank SubtiBank
yabE
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yabE

similar to cell wall binding protein
locus
BSU00400
pI
9.28
mw
47.55 kDa
protein length
437 aa Sequence Blast
gene length
1311 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • Gene

    Coordinates
    48,629 → 49,942

    The protein

    [SW|Domains]

  • contains a SPS domain
  • Expression and Regulation

    Operons

    genes
    [gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]
    description
    [Pubmed|19047346]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19047346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is negatively controlled by a cis-acting antisense RNA that is dependent on [protein|search|SigX] and [protein|search|SigM] [http://www.ncbi.nlm.nih.gov/sites/entrez/19047346 PubMed]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B905 (yabE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1904 NBRP B. subtilis, Japan]
  • BKE00400 (Δ[gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT, downstream forward: _UP4_TAGTATATACTTATGTATTC
  • BKK00400 (Δ[gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT, downstream forward: _UP4_TAGTATATACTTATGTATTC
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 19047346,26883633