SubtiBank SubtiBank
lutA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lutA

lactate catabolic enzyme
locus
BSU_34050
pI
6.25
mw
26.24 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
function
lactate utilization
product
lactate oxidase
essential
no
synonyms
yvfV

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    3,494,985 → 3,495,701

    Phenotypes of a mutant

  • no growth with lactate as the single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of lactate to pyruvate [Pubmed|19201793]
  • Protein family

  • LutA/YkgE family (single member, according to UniProt)
  • Structure

  • [PDB|5ODC] (from Methanothermococcus thermoautotrophicus, 24% identity) [pubmed|28818947]
  • Expression and Regulation

    Operons

    genes
    [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]
    description
    [Pubmed|19201793]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19201793], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • induction by lactate [Pubmed|19201793]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|22427629]
  • [protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|FbpB]: translation inhibition,
  • Biological materials

    Mutant

  • MGNA-A497 (yvfV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/497 NBRP B. subtilis, Japan]
  • BKE34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA, downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
  • BKK34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA, downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
  • lacZ fusion

  • GP1612 amyE::p(lutA-lacZ cat), constructed with pGP2149 based on [SW|pAC5], available in [SW| Jörg Stülke]'s lab
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

  • 22427629,16430695,19201793,25031425,28818947