SubtiBank SubtiBank
pdxK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pdxK

pyridoxine, pyridoxal, and pyridoxamine kinase
locus
BSU_38020
pI
4.92
mw
28.87 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
function
biosynthesis of pyridoxal phosphate
product
pyridoxine, pyridoxal, and pyridoxamine kinase
essential
no
ec
2.7.4.7
synonyms
ywdB,ipa-52r,thiD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.12|Biosynthesis of pyridoxal phosphate]
  • Gene

    Coordinates
    3,900,963 → 3,901,778

    The protein

    Catalyzed reaction/ biological activity

  • ATP + 4-amino-2-methyl-5-phosphomethylpyrimidine = ADP + 4-amino-2-methyl-5-diphosphomethylpyrimidine (according to Swiss-Prot)
  • Protein family

  • ThiD family (with [protein|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|ThiD], according to UniProt)
  • Paralogous protein(s)

  • [protein|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|ThiD]
  • Structure

  • [PDB|2I5B] [pubmed|16978644]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]
    description
    [Pubmed|3100393]
    view in new tab

    Biological materials

    Mutant

  • BKE38020 (Δ[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGAACCTCCATCA, downstream forward: _UP4_TAAAAAAAGGGGCTGCCTTA
  • BKK38020 (Δ[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGAACCTCCATCA, downstream forward: _UP4_TAAAAAAAGGGGCTGCCTTA
  • References

  • 17012797,14973012,3100393,16978644