SubtiBank SubtiBank
lonA
The papers of the month are back! Check them out! Link here

lonA

class III heat-shock ATP-dependent protease
locus
BSU28200
pI
5.77
mw
86.42 kDa
protein length
774 aa Sequence Blast
gene length
2322 bp Sequence Blast
function
protein quality control, control of swarming motility
product
class III heat-shock ATP-dependent protease
essential
no
synonyms
lon

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    2,880,466 → 2,882,790

    Phenotypes of a mutant

  • presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]
  • The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins in presence of ATP (according to Swiss-Prot)
  • inhibits swarming motility by preventing accumulation of SwrA in liquid medium [Pubmed|25538299]
  • Protein family

  • peptidase S16 family (according to Swiss-Prot)
  • Structure

  • [PDB|5E7S] (active hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041593]
  • [PDB|4YPN] (ADP-bound hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041592]
  • [PDB|3M65] (N-terminal domain) [Pubmed|20600124]
  • [PDB|3M6A] (C-terminal domain) [Pubmed|20600124]
  • [PDB|1X37] (Ssd domain)
  • [SW|Localization]

  • coincident with the nucleoid during normal growth and localized to the forespore during development [Pubmed|18689473]
  • Expression and Regulation

    Operons

    genes
    [gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]-[gene|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|ysxC]
    description
    [Pubmed|7961402]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7961402], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9852015], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
  • view in new tab

    Biological materials

    Mutant

  • BKE28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT, downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
  • BKK28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT, downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
  • References

    Reviews

  • 23479438,26639779
  • Original publications

  • 7961403,7961402,19542270,19643080,9852015,18689473,20600124,25538299,27041592,27041593,29311275