SubtiBank SubtiBank
ywmA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywmA

unknown
locus
BSU_36790
pI
4.45
mw
18.84 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,780,562 → 3,781,035

    Expression and Regulation

    Operons

    genes
    [gene|FF20ADE4A168429A0389C7B7A459EBF9EA0C3397|ywmA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A188 (ywmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/188 NBRP B. subtilis, Japan]
  • BKE36790 (Δ[gene|FF20ADE4A168429A0389C7B7A459EBF9EA0C3397|ywmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTTGCCAGCTCCTTTC, downstream forward: _UP4_TAAAAAAATCCTTCTCATAA
  • BKK36790 (Δ[gene|FF20ADE4A168429A0389C7B7A459EBF9EA0C3397|ywmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTTGCCAGCTCCTTTC, downstream forward: _UP4_TAAAAAAATCCTTCTCATAA