SubtiBank SubtiBank
ksgA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ksgA

rRNA adenine dimethyltransferase
locus
BSU_00420
pI
5.71
mw
32.57 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
rRNA maturation
product
rRNA adenine dimethyltransferase
essential
no
ec
2.1.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    50,640 → 51,518

    The protein

    Catalyzed reaction/ biological activity

  • adenosine1518/adenosine1519 in 16S rRNA + 4 S-adenosyl-L-methionine --> 4 H+ + N6-dimethyladenosine1518/N6-dimethyladenosine1519 in 16S rRNA + 4 S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|6IFT] (complexed with S-adenosylmethionine) [Pubmed|30624914]
  • [PDB|6IFS] [Pubmed|30624914]
  • [PDB|6IFV] (C-terminal truncation) [Pubmed|30624914]
  • [PDB|6IFW] (Chimeric protein) [Pubmed|30624914]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5BA7AA691CFE4635DEFBD0B8B820F487B58A5DB7|rnmV]-[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]
    description
    [Pubmed|11233981]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B907 (ksgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1906 NBRP B. subtilis, Japan]
  • BKE00420 (Δ[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTCATTCTGTTCCTC, downstream forward: _UP4_TAAAAGGGCTTTTTGTTTTG
  • BKK00420 (Δ[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTCATTCTGTTCCTC, downstream forward: _UP4_TAAAAGGGCTTTTTGTTTTG
  • References

  • 16497325,19001112,11233981,19285505,30624914