SubtiBank SubtiBank
mntR
The papers of the month are back! Check them out! Link here

mntR

transcriptional regulator, controls manganese import and efflux
locus
BSU24520
pI
5.63
mw
16.60 kDa
protein length
142 aa Sequence Blast
gene length
426 bp Sequence Blast
function
regulation of manganese transport
product
transcriptional regulator (DtxR family)
essential
no
synonyms
yqhN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,543,440 → 2,543,868

    Phenotypes of a mutant

  • inactivation of ''[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]'' reduces sporulation efficiency to 8.9% that of wild type cells [Pubmed|26735940]
  • highly sensitive to Mn(II) intoxication [Pubmed|27748968]
  • The protein

    [SW|Cofactors]

  • Mn(2+) acts as co-repressor (according to [Pubmed|20408793])
  • Structure

  • [PDB|2F5D] (complex with manganese), [PDB|2HYG] (apo-form)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000054 PRODORIC2 database]
  • Biological materials

    Mutant

  • MGNA-C435 (yqhN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2433 NBRP B. subtilis, Japan]
  • BKE24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA, downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
  • BKK24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA, downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • References

    Reviews

  • 20408793,25160631
  • Original Publications

  • 17176058,12675807,17118401,16533030,15736948,14580210,12847518,23298157,12950915,10760146,26735940,27748968