SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator, controls manganese import and efflux
16.60 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
regulation of manganese transport
transcriptional regulator (DtxR family)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,543,440 → 2,543,868

    Phenotypes of a mutant

  • inactivation of ''[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]'' reduces sporulation efficiency to 8.9% that of wild type cells [Pubmed|26735940]
  • highly sensitive to Mn(II) intoxication [Pubmed|27748968], this can be suppressed by mutations that inactivate [protein|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|MntH] [pubmed|31964700]
  • The protein

    Protein family

  • DtxR/MntR family (single member, according to UniProt)
  • [SW|Domains]

  • HTH dtxR-type domain (aa 1-63) (according to UniProt)
  • [SW|Cofactors]

  • Mn(2+) acts as co-repressor (according to [Pubmed|20408793])
  • Structure

  • [PDB|2F5D] (complex with manganese) [pubmed|16533030]
  • [PDB|2HYG] (apo-form)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-C435 (yqhN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA, downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
  • BKK24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA, downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • References


  • 20408793,25160631
  • Original Publications

  • 17176058,12675807,17118401,16533030,15736948,14580210,12847518,23298157,12950915,10760146,26735940,27748968,31685536,31818924,31964700