SubtiBank SubtiBank
yyzE

yyzE

similar to [category|SW 1.2.2|PTS], EIIA component (truncated)
locus
BSU_40120
pI
5.04
mw
8.11 kDa
protein length
gene length
231 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    4,122,619 → 4,122,849

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-1 (aa 1-76) (according to UniProt)
  • Structure

  • [PDB|1AX3] (IIA domain of [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG], 44% identity) [pubmed|9593197]
  • Expression and Regulation

    Operons

    genes
    [gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]-[gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE40120 (Δ[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAACCGTAATGACGC, downstream forward: _UP4_GTCGTAAGCTGAGGAGGAAT
  • BKK40120 (Δ[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAACCGTAATGACGC, downstream forward: _UP4_GTCGTAAGCTGAGGAGGAAT
  • References

  • 10627040,9593197