SubtiBank SubtiBank
yuaF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yuaF

NfeD2, role in maintaining membrane integrity during conditions of cellular stress, confers (together with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT]) resistance to cefuroxime
locus
BSU_31020
pI
4.04
mw
18.46 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
function
involved in the control of membrane fluidity
product
NfeD family protein NfeD2
essential
no
synonyms
NfeD2

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,182,015 → 3,182,539

    The protein

    Catalyzed reaction/ biological activity

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]-dependent expression of ''[gene|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|fabF]'' and the ''[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]'' operon result in reduced membrane fluidity [Pubmed|21542858,22178969]
  • Protein family

  • NfeD family (with [protein|F6B0D27B434D81B7A680555E4457F266B6206B7D|YqeZ])
  • Structure

  • [PDB|2K14] [pubmed|18696230]
  • [SW|Localization]

  • cell membrane, in focal structures [Pubmed|22753055]
  • Expression and Regulation

    Operons

    genes
    [gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed upon cell wall stress ([protein|search|SigW]) [Pubmed|9987136]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A212 (yuaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/212 NBRP B. subtilis, Japan]
  • BKE31020 (Δ[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTCATCCTTTCTT, downstream forward: _UP4_TAACATAAAAGGAGGAATTT
  • BKK31020 (Δ[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTCATCCTTTCTT, downstream forward: _UP4_TAACATAAAAGGAGGAATTT
  • References

  • 18696230,9987136,22753055,27362352