ypoP

ypoP
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_21700
Molecular weight
16.72 kDa
pI
9.26
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ypoP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
2,288,194  2,288,619
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 4-139) (according to UniProt)
Structure
[PDB|2RDP] (from Geobacillus stearothermophilus, 25% identity)
[AF|P54182]
Expression and Regulation
Operons
genes
[gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]
description
[Pubmed|22383849]
Open in new tab

[gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]

2022-06-21 04:51:07

Jstuelk

8

bb4349b67d186c8ad3f4e6527ea1b5160a488883

D1A32790A6F960DCA95E8C86C00226AEDC7D0219

Biological materials
Mutant
MGNA-A891 (ypoP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/891 NBRP B. subtilis, Japan]
BKE21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT,  downstream forward: _UP4_TGAAAAAAAGCACATACCGA
BKK21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT,  downstream forward: _UP4_TGAAAAAAAGCACATACCGA

0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8

Page visits: 841

Time of last update: 2022-07-02 04:09:02

Author of last update: Melvin.boenninger