SubtiWiki SubtiWiki
rqcH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rqcH
168

ribosome-associated protein quality control factor, selects tRNAAla during RQC elongation

locus
BSU_15640
Molecular weight
65.30 kDa
pI
8.98
Protein length
Gene length
function
rescue of stalled ribosomes
product
ribosome-associated protein quality control factor
essential
no
synonyms
rqcH, yloA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1293

This gene is a member of the following regulons

Gene
Coordinates
1,636,131  1,637,849
Phenotypes of a mutant
defective in [wiki|biofilm formation] [pubmed|28294433]
The protein
Catalyzed reaction/ biological activity
senses stalled translation intermediates and recruits tRNAAla(UGC) to modify nascent-chain C termini with a polyalanine degron for degradation [pubmed|34255840,33259811]
Protein family
NEMF family (single member, according to UniProt)
Expression and Regulation
Operons
genes
[gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]
description
[pubmed|22383849]
regulation
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression during logarithmic growth [Pubmed|28294433]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression during stationary phase [Pubmed|28294433]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [pubmed|28294433], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, [pubmed|28294433], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
Open in new tab

[gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]

2021-12-16 12:45:06

Jstuelk

9

29a04bf16d345a1e9def0254967c2d97c5ec4025

16AF2F8748CFED90DEDBEEF2375C91492E353A84

Biological materials
Mutant
MGNA-B371 ([gene|search|yloA]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1370 NBRP B. subtilis, Japan]
BKE15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT,  downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
BKK15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT,  downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
References
Reviews
33815344,34488571
Original Publications
28294433,21873635,31155236,33259811,33259810,34255840

003047E90159765F9F0E499FD760F95FFF4AC360

Page visits: 1628

Time of last update: 2022-01-21 01:59:52

Author of last update: Jstuelk