SubtiWiki SubtiWiki
gmuB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

gmuB
168

glucomannan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW.1.2.2|PTS]

locus
BSU_05810
Molecular weight
11.30 kDa
pI
4.72
Protein length
Gene length
function
glucomannan uptake and phosphorylation
product
glucomannan-specific lichenan-specific [category|SW.1.2.2|PTS], EIIB component
essential
no
synonyms
gmuB, ydhM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1440

This gene is a member of the following regulons

Gene
Coordinates
626,622  626,933
The protein
Catalyzed reaction/ biological activity
D-cellobiose + Nπ-phospho-L-histidyl-[protein] --> 6-phospho-β-D-glucosyl-(1→4)-D-glucose + L-histidyl-[protein] (according to UniProt)
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-3 (aa 1-103) (according to UniProt)
Structure
[PDB|4MGE] (from B. anthracis, 46% identity)
Paralogous protein(s)
[protein|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]
Expression and Regulation
Operons
genes
[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
description
[Pubmed|18177310]
regulation
induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]) [Pubmed|18177310]
regulatory mechanism
[protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]: repression, [Pubmed|18177310], in [regulon|protein:64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|18177310], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18177310], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]→[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]

2022-01-24 21:04:31

Jstuelk

11

1716709ba10a9af523abc0d89eb44ea784dd12d9

42FBC6CD7712CC913DB98C4B417CB4A13C8FAE20

Biological materials
Mutant
MGNA-C188 (ydhM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2186 NBRP B. subtilis, Japan]
BKE05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT,  downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
BKK05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT,  downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
References
18177310,10627040,22900538,20817675

00A4A90685CED4AD46829C45718CF26F1D62F5D3

Page visits: 2107

Time of last update: 2022-01-27 13:54:44

Author of last update: Melvin.boenninger