

similar to thioesterase

Molecular weight
13.64 kDa
Protein length
Gene length
yuxO, srfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2050 (Galperin et al., 2021)

This gene is a member of the following regulons

3,252,405  3,252,785
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
thioesterase PaaI family (single member, according to UniProt)
[PDB|4QD8] (from Pseudomonas aeruginosa, 45% identity) [pubmed|]
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-04-07 20:03:48





Biological materials
MGNA-B560 (yuxO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1559 NBRP B. subtilis, Japan]
BKE31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA,  downstream forward: _UP4_TAAAAAAACAGCCGGAACTC
BKK31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA,  downstream forward: _UP4_TAAAAAAACAGCCGGAACTC


Page visits: 1998

Time of last update: 2024-04-23 18:55:16

Author of last update: Melvin.boenninger