yuxO

yuxO
168

similar to thioesterase

locus
BSU_31670
Molecular weight
13.64 kDa
pI
6.47
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yuxO, srfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2050

This gene is a member of the following regulons

Gene
Coordinates
3,252,405  3,252,785
The protein
Protein family
thioesterase PaaI family (single member, according to UniProt)
Structure
[PDB|4QD8] (from Pseudomonas aeruginosa, 45% identity) [pubmed|]
[AF|P14205]
Expression and Regulation
Operons
genes
[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]-[gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]-[gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]→[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]

2022-12-02 09:08:04

Jstuelk

45

150fea5ac7a55e0a32a0fafb306d0c860c9a2be7

E73017881E40042997BB444071E259402A0F5D1F

Biological materials
Mutant
MGNA-B560 (yuxO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1559 NBRP B. subtilis, Japan]
BKE31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA,  downstream forward: _UP4_TAAAAAAACAGCCGGAACTC
BKK31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA,  downstream forward: _UP4_TAAAAAAACAGCCGGAACTC
References
2507523

015989AAB862E418C944AB35DA3605863F059CE9

Page visits: 1459

Time of last update: 2022-12-09 03:27:48

Author of last update: Melvin.boenninger