ydbD

ydbD
168

general stress protein, similar to manganese-containing catalase

locus
BSU_04430
Molecular weight
30.11 kDa
pI
4.86
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
synonyms
ydbD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3546

This gene is a member of the following regulons

Gene
Coordinates
495,740  496,561
The protein
Catalyzed reaction/ biological activity
2 H2O2 --> O2 + 2 H2O (according to UniProt)
Protein family
[wiki|catalase family] (according to UniProt)
Structure
[PDB|1JKU] (from Lactobacillus plantarum, 51% identity) [pubmed|11587647]
[AF|P80878]
Paralogous protein(s)
[protein|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC], [protein|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]
Expression and Regulation
Operons
genes
[gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]-[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]
description
[Pubmed|10708364]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]→[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]

2022-11-22 17:39:29

ghost

27

0c4ad99df7b136d668ce6c0563d387d07a26668b

25539691E40591F4440AB70FBF0BE100FF4DF73C

genes
[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
Open in new tab

[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]

2022-11-26 13:22:24

ghost

13

96dd3b9ce6a4d1113ad8a66a783ced2e318561b2

D6F9CF11D8A270A0620694275A4C7A5EA6D1276D

Biological materials
Mutant
BKE04430 ([gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACCCATCTCCTTTTT,  downstream forward: _UP4_TAAAGAGACAAGCCCAAAAC
BKK04430 ([gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACCCATCTCCTTTTT,  downstream forward: _UP4_TAAAGAGACAAGCCCAAAAC
References
15805528,10708364,11587647

01CE4BBBEB0C0855201D396FB8036F72B64EA7DD

Page visits: 2108

Time of last update: 2022-12-06 02:33:32

Author of last update: Melvin.boenninger