SubtiWiki SubtiWiki
yomJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yomJ
168

similar to phage-related immunity protein

locus
BSU_21340
Molecular weight
25.09 kDa
pI
6.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yomJ, d-gene

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,248,417  2,249,100
Expression and Regulation
Operons
genes
[gene|01E26F18E410323F1DE1FAD2D1C15FBB53C072B3|yomJ]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|01E26F18E410323F1DE1FAD2D1C15FBB53C072B3|yomJ]

2021-09-29 12:20:05

Bzhu

2

f69e9e7a18e799b8377422ee0d875e3e011977dc

D06605EF19A3D574B52D2D1ED30F28FBACD9D07B

Biological materials
Mutant
BKE21340 ([gene|01E26F18E410323F1DE1FAD2D1C15FBB53C072B3|yomJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACCACCGCCGGTAT,  downstream forward: _UP4_TAACTGAGTGGCTTTTTTCT
BKK21340 ([gene|01E26F18E410323F1DE1FAD2D1C15FBB53C072B3|yomJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACCACCGCCGGTAT,  downstream forward: _UP4_TAACTGAGTGGCTTTTTTCT
References
20817675, 3091583

01E26F18E410323F1DE1FAD2D1C15FBB53C072B3

Page visits: 1037

Time of last update: 2021-12-29 13:19:38

Author of last update: Rhertel